IMGT/V-QUEST Documentation

http://www.imgt.org

Citing IMGT/V-QUEST: Brochet, X. et al., Nucl. Acids Res. 36, W503-508 (2008). PMID: 18503082

• Introduction
• IMGT/V-QUEST selection and input
• IMGT/V-QUEST reference directory sets
• IMGT/V-QUEST output: A. Detailed view
1. Alignment for V-GENE and allele identification
2. Alignment for D-GENE and allele identification
3. Alignment for J-GENE and allele identification
4. Results from IMGT/JunctionAnalysis
5. Sequence of the JUNCTION ('nt' and 'AA')
6. V-REGION alignment
7. V-REGION translation
8. V-REGION protein display
9. V-REGION mutation table
10. V-REGION mutation statistics
11. V-REGION mutation hot spots
12. IMGT Collier de Perles
13. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA.
14. Annotations by IMGT/Automat
• IMGT/V-QUEST output: B. Synthesis view
1. Alignment for V-GENE
2. V-REGION alignment
3. V-REGION translation
4. V-REGION protein display
5. V-REGION protein display with colored AA according to IMGT AA classes
6. V-REGION protein display (mutations displayed)
7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT
8. Results of IMGT/JunctionAnalysis
• Results provided following "Search for insertions and deletions" (Advanced parameters)
1. Results provided in case of insertions
2. Results provided in case of deletions
• Export in Excel file
• IMGT/V-QUEST upgrade and new versions

IMGT/V-QUEST (V-QUEry and STandardization) [1, 10] at Montpellier is an integrated alignment tool for the immunoglobulin (IG) and T cell receptor (TR) nucleotide sequences. IMGT/V-QUEST compares your germline or rearranged IG or TR variable sequences with the IMGT/V-QUEST reference directory sets.

Note that:

• IMGT/V-QUEST works with rearranged V-J and V-D-J genes and germline V-GENEs, but does not work with germline D-GENEs or J-GENEs.
• IMGT/V-QUEST can optionally analyse sequences with DNA insertions or deletions (which do not respect the IMGT unique numbering). For more information, see Search for insertions and deletions.
• Sequences containing two V domains (as scFv) need to be split (at the level of the linker) prior to IMGT/V-QUEST analysis.
• IMGT/V-QUEST does not work with out-of-frame pseudogenes as they cannot be numbered according to the amino acid IMGT unique numbering. You may use BLAST (http://www.imgt.org/blast/blast.html) in order to compare your sequence with F+ORF+all P genes and alleles IMGT reference sequences (select for « Database » : "IMGT/GENE-DB reference sequences").
• IMGT/V-QUEST does not work, or will give aberrant results, for too short partial sequences, sequences containing a cluster of V-GENEs, or sequences with too long 5'UTR or 3'UTR.
  For these sequences, you may use BLAST (http://www.imgt.org/blast/blast.html) in order to identify homologous sequences against IMGT/LIGM-DB (select for « Database » : "IMGT/LIGM-DB") .

IMGT/V-QUEST is available for IG and TR from different species from the IMGT/V-QUEST Home page.
Select the antigen receptor (Immunoglobulin or T cell receptor) and the species in the IMGT/V-QUEST Home page.

- Your selection
- Nucleotide sequences
- Selection for results display
- Advanced parameters

• Your selection

  The IMGT/V-QUEST reference directory set, against which your sequences are compared, is indicated.

• Nucleotide sequences

  "Type (or copy and paste) your sequence(s) in FASTA format" in the text area or select the "Or give the path access to a local file containing your sequence(s) (in FASTA format)" option .
  

  Here are examples of sequences in the required format :

  Test sequences (human IG):
  
  >AF184762
  atggagtttgggctgagctgggttttccttgttgctattttaaaaggtgtccactgtgag
  gtgcagctggtggagtctgggggaggcttagtccagcctgggggatccctgaaactctcc
  tgtgcagcctctgggttcaccctcagtggctcaaatgtgcactgggtccgccaggcctcc
  gggaaagggctggagtgggttggccgtatcaaaaggaatgctgagtctgacgcgacagca
  tatgctgcgtcgatgagaggcaggctcaccatctccagagatgattcaaagaacacggcg
  tttctgcaaatgaacagcctgaaaagcgatgacacggccatgtattattgtgtgatccgg
  ggagatgtttacaaccgacagtggggccagggaaccctggtcaccgtctcctcagcatcc
  ccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagat
  
  >AF069038
  tcctcctcctccactgcacaaggtctctctccccggtcatgctgacgcaatcaccctcta
  tttctgcctccctgggagcctcggtcaacctcacctgcactctgaccagtgggcacagac
  gttacgccatcgcatggcatcagcaattgtcagggaagggccctcgtttcttgatgagac
  ttaacagtgatggcacttacaccaggggggacgggattcctgatcgcttctccggctcca
  cctctgggcctgagcgctacctcaccatctccagcctccagtctgaagatgaggcagatt
  attactgtcagacctggggcactggcctttgggttttcggcggagggaccagtctgaccg
  tcttaggtcagcccaaggctgccccctcg
  
  Test sequences (human TR):
  
  >AF020636
  tgacaagcattactgtactcctatctttgggtattatgggtgatgctaagaccacacagc
  caaattcaatggagagtaacgaagaagagcctgttcacttgccttgtaaccactccacaa
  tcagtggaactgattacatacattggtatcgacagcttccctcccagggtccagagtacg
  tgattcatggtcttacaagcaatgtgaacaacagaatggcctctctggcaatcgctgaag
  acagaaagtccagtaccttgatcctgcaccgtgctaccttgagagatgctgctgtgtact
  actgcatcctgacctcatataacaccgacaagctcatctttgggactgggaccagattac
  aagtctttccaaatatccagaaccctgaccctgccgtgtaccagct
  
  >AF512447
  gcaggtcacctagagcaacctcaaatttccagtactaaaacgctgtcaaaaacagcccgc
  ctggaatgtgtggtgtctggaataacaatttctgcaacatctgtatattggtatcgagag
  agacctggtgaagtcatacagttcctggtgtccatttcatatgacggcactgtcagaaag
  gaatccggcattccgtcaggcaaatttgaggtggataggatacctgaaacgtctacatcc
  actctcaccattcacaatgtagagaaacaggacatagctacctactactgtgccttgtgg
  gtagagttgggcaaaaaaatcaaggtatttggtcccggaacaaagcttatcattacagat
  aaacaactt
  

  Other sets of sequences to test the IMGT/V-QUEST functionalities are available here.

• Selection for results display
  • Display type and Nb of nucleotides per line in alignments:
    • Three types of display are available:
      
      • Display in HTML, for both "Detailed view" and "Synthesis view")
      • Export in text, for both "Detailed view" and "Synthesis view")
      • Export in Excel file : the "Detailed view" results are recorded in 11 sheets.
    • The number of nucleotides per line in the alignments may be defined.

  • "Detailed view". You may select your output parameters. Only the results selected in the list will be displayed:

    1. Alignment for V-GENE
    2. Alignment for D-GENE
    3. Alignment for J-GENE
    4. Results of IMGT/JunctionAnalysis
    5. Sequence of the JUNCTION ('nt' and 'AA')
    6. V-REGION alignment
    7. V-REGION translation
    8. V-REGION protein display
    9. V-REGION mutation table
    10. V-REGION mutation statistics
    11. V-REGION mutation hot spots
    12. IMGT Collier de Perles
    13. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA. Access to IMGT/PhyloGene for V-REGION ('nt')
    14. Annotation by IMGT/Automat
    

  • "Synthesis view". You may then select your output parameters. Only the results selected in the list will be displayed:

    1. Alignment for V-GENE
    2. V-REGION alignment
    3. V-REGION translation
    4. V-REGION protein display
    5. V-REGION protein display (with colored AA according to IMGT AA classes)
    6. V-REGION protein display (only AA changes diplayed)
    7. V-REGION most frequently occurring AA
    8. Results of IMGT/JunctionAnalysis
    

• Advanced parameters (at the bottom of the query page)
  allow to modify the default parameters used by IMGT/V-QUEST and IMGT/JunctionAnalysis. The parameters comprise:
  • The Selection of IMGT reference directory set. Four options are available:
    • F+ORF (only functional and ORF genes)
    • F+ORF+in-frame P (functional and ORF genes and in-frame pseudogenes: default)
    • F+ORF including orphons (only functional and ORF genes including orphons)
    • F+ORF+in-frame P including orphons (functional and ORF genes and in-frame pseudogenes including orphons)
  • The choice to compare the user sequences with all alleles or with only allele *01 of the genes of the IMGT/V-QUEST reference directory set.
  • The Search for insertions and deletions for sequences which do not respect the IMGT unique numbering). In that case, the nb of submitted sequences in a single run is limited to 10.
  • The Parameters for IMGT/JunctionAnalysis allowing
    - to set the number of D-GENE to be allowed in IGH, TRB and TRD JUNCTION for IMGT/JunctionAnalysis.

    Default values are:

    Locus	Nb of allowed D-GENE
    IGH	1
    TRB	1
    TRD	3

    - to set the number of accepted mutations in 3'V-REGION, D-REGION and 5'J-REGION for IMGT/JunctionAnalysis. Default values are:
    

    Locus	3'V-REGION and 5'J-REGION	D-REGION
    IGH	2	4
    IGK	7	NR
    IGL	7	NR
    TRA	0	NR
    TRB	0	0
    TRD	0	0
    TRG	0	NR

    NR= non relevant

  • The Parameters for "Detailed view" which allows:
    - to set the number of nucleotides to exclude in 5' of the V-REGION for V-REGION mutation statistics and V-REGION mutation hot spots (results number 8 and 9).
    - to set the number of nucleotides to add or to exclude in 3' of the V-REGION for the evaluation of the alignment score (result 1).

    Default values are:

    Locus	Last codon (according to the IMGT numbering) of the V-REGION taken into account for the evaluation of the alignment score and closest GENE and allele identification
    IGH	104
    IGK	109
    IGL	110
    IGI	109
    TRA	104
    TRB	104
    TRD	104
    TRG	104

• For "Text only" Display type, IMGT Collier de Perles (Detailed view) and Results of IMGT/JunctionAnalysis (Synthesis view) are not included.
  The tables V-REGION mutation statistics, V-REGION mutation table and V-REGION mutation hot spots (Detailed view) and the results of V-REGION most frequently occurring AA (Synthesis view) are presented in CSV (Coma Separated Value) format.

• Depending on your selection in the IMGT/V-QUEST Home page (Immunoglobulin or T cell Receptor, species), your sequence will be compared to a given IMGT/V-QUEST reference directory set. To see the content of the available IMGT/V-QUEST reference directory sets, click here.

• The IMGT/V-QUEST reference directory sets are constituted by sets of sequences which contain the V-REGION, D-REGION and J-REGION alleles, isolated from the Functional and ORF allele IMGT reference sequences.
• Since the version Version 2.3.0 of the 5th of July 2007 all "in-frame" Pseudogene (indicated with (P) following the allele name) and the orphons have been included.
• By definition, these sets contain one sequence for each allele. Allele names of these sequences are shown in red in Alignments of alleles.

A. Detailed results for the IMGT/V-QUEST analysed sequences

The top of the IMGT/V-QUEST result page indicates the number of analysed sequences in the current run.
The name of each sequence is directly linked to its corresponding results.

For each analysed sequence, the IMGT reference directory set used for the alignments (for example, human IG set) is indicated. The sequence is displayed in FASTA format.

If an input sequence was provided in the antisense orientation, IMGT/V-QUEST complementary reverses it automatically, and the results will be shown on the complementary reverse sequence (that is in "sense" orientation for the V-GENE) .

A summary of the results is provided as a table:
• The functionality of the sequence, evaluated by IMGT/V-QUEST, is indicated on the first row.
  For example: "Productive IGH rearranged sequence (no stop codon and in-frame junction)".
• A note appears in the result summary top line when:
  - the V identity percentage is less than 85% and/or when the closest germline and the analysed sequence show different CDR1-IMGT and/or CDR2-IMGT amino acid lengths: this may indicate potential nucleotide insertion(s) and/or deletion(s) (see Somatic hypermutations by insertion or deletion in rearranged cDNA: Human IGHV and [2])
  Be aware that a single insertion or deletion will be undetected if the identity percentage is more than 85% and if the CDR1-IMGT length and the CDR2-IMGT length are not altered. However, they will be visible in 1. Alignment for V-GENE and allele identification, 6. V-REGION alignment, and 7. V-REGION translation
  - the V score is very low (less than 200)
  
• The names of the V-GENE and allele and J-GENE and allele are indicated with their alignment score and the percentage of identity.
• If less than 6 nucleotides of the user sequence are aligned the J-GENE: the J-GENE and allele name is not provided and the message "Less than 6 nucleotides are aligned" is indicated.
• A note may appear with the J-GENE and allele name: this indicates that other possibilities exist for the choice of the J-GENE and allele name.
  
• The D-GENE and allele name, the CDR-IMGT lengths and the AA JUNCTION are provided according to the IMGT/JunctionAnalysis results.

The results may include (if selected in the input page):
1. Alignment for V-GENE and allele identification
2. Alignment for D-GENE and allele identification
3. Alignment for J-GENE and allele identification
4. Results of IMGT/JunctionAnalysis
5. Sequence of the JUNCTION ('nt' and 'AA')
V-REGION alignment
6. V-REGION translation
7. V-REGION protein display
8. V-REGION mutation table
9. V-REGION mutation statistics
10. V-REGION mutation hot spots (motifs and positions in germline V-REGION)
11. IMGT Collier de Perles
12. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA.
13. Annotations by IMGT/Automat

Example : the sequence of AF184762 accession number.




1. Alignments for the V-GENE and allele identification

   
   This alignment shows your sequence aligned with the closest V-REGION alleles from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.

   • The gene and allele functionality is only shown for pseudogene (P) and "ORF" (ORF) between parentheses.

   • The score is calculated by counting +5 for each nucleotide match and -4 for each mismatch. The score allows to emphasize differences between the IMGT reference directory sequences and the input sequence, since a single nucleotide mismatch corresponds to a difference of 9 in the score.

   • For each alignment, the score and the percentage of nucleotide identity are indicated. The number of identical nucleotides and the total number of nucleotides (excluding gaps) used for this evaluation are indicated between parentheses.

   

2. Alignments for the D-GENE and allele identification

   If this option has been selected in the query page, this alignment shows your sequence aligned with the closest D-REGION alleles from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.

   • The score is calculated by counting +5 for each nucleotide match and -4 for each mismatch. The score allows to emphasize differences between the IMGT reference directory sequences and the input sequence, since a single nucleotide mismatch corresponds to a difference of 9 in the score.

   • For each alignment, the score and the percentage of nucleotide identity are indicated. The number of identical nucleotides and the total number of nucleotides (excluding gaps) used for this evaluation are indicated between parentheses.

   • The alignments for the D-REGION and the J-REGION start from the end of the V-REGION.

   • The "Alignment for D-GENE and allele identification" provided by IMGT/V-QUEST may show discrepancies with the results obtained by IMGT/JunctionAnalysis as the way to identify the D-REGIONs is different between the two tools [1,3,4,5]. In case of discrepancies, the results of IMGT/JunctionAnalysis are the most accurate [4,5].
     However, the alignment provided by IMGT/V-QUEST may be useful in some cases for extensive comparison.
   

3. Alignments for the J-GENE and allele identification
.
This alignment shows your sequence aligned with the closest J-REGION alleles from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.
• The score is calculated by counting +5 for each nucleotide match and -4 for each mismatch. The score allows to emphasize differences between the IMGT reference directory sequences and the input sequence, since a single nucleotide mismatch corresponds to a difference of 9 in the score.

• For each alignment, the score and the percentage of nucleotide identity are indicated. The number of identical nucleotides and the total number of nucleotides (excluding gaps) used for this evaluation are indicated between parentheses.



4. Results of IMGT/JunctionAnalysis
.

Depending on the selection you made in the IMGT/V-QUEST input page, and depending on your sequence, the results of IMGT/JunctionAnalysis [4] or the translation of the JUNCTION will be displayed.
• A JUNCTION will extend from 2nd-CYS 104 to J-PHE or J-TRP included. J-PHE or J-TRP are easily identified when the conserved Phe/Trp-Gly-X-Gly motif of the J-REGION is present. The translation is displayed up to the motif (not included) if the motif is present in your sequence or in the closest J-REGION, or up to the end of your sequence if the motif is not found.


• Analysis of the JUNCTION and Translation of the JUNCTION
  If the option "Includes IMGT/JunctionAnalysis" is selected, the results from IMGT/JunctionAnalysis are displayed.
  • By default, only one D-GENE is searched in the IGH junctions, two in the TRB junctions and three in the TRD junctions. You are allowed to modify this value in input options (Nb of D-GENE in IGH (or TRB or TRD) JUNCTIONs) of the IMGT/V-QUEST query page.
  • The results of IMGT/JunctionAnalysis are detailed in IMGT/JunctionAnalysis documentation.
  • The number of accepted mutations in 3'V-REGION, D-REGION, and 5'J-REGION corresponds to the default values indicated in IMGT/JunctionAnalysis documentation except for unmutated IG V-GENE (no mutations in FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT and FR3-IMGT). In this case, the number of accepted mutations is:
    - 0 in 3'V-REGION and 5'J-REGION, and 2 in D-REGION of IGH sequences
    - 2 in 3'V-REGION and 5'J-REGION of IGK and IGL sequences

  The IMGT/JunctionAnalysis results comprise:

  
  JUNCTION amino acid are colored according to the IMGT amino acid classes for chemical characteristics [8].
• Eligible D-GENEs
  This option "with full list of eligible D-GENEs" is not selected by default in the IMGT/V-QUEST query page. If selected, IMGT/JunctionAnalysis displays all eligible D-GENEs and alleles with the length of the germline D-REGION, the sequence identified in the JUNCTION (hyphens indicate similarity), the alignment score and the number of mutations. The column on the right side indicates the location of the aligned nucleotides in the D-REGION (for example d[3-8]), and the location of the aligned nucleotides in the JUNCTION (for example s[22-27]);
  
  If, in the current conditions, IMGT/JunctionAnalysis is unable to provide a result, the sequence of the JUNCTION is shown (see below). as well as the JUNCTION nucleotide sequence formatted for the IMGT/JunctionAnalysis tool.

5. Sequence of the JUNCTION ('nt' and 'AA')
The sequence of the JUNCTION is diplayed in nucleotide and in amino acid with the IMGT unique numbering.

6. V-REGION alignment


The sequences are shown with the IMGT unique numbering and with the IMGT framework region ( FR-IMGT) and complementarity determining region ( CDR-IMGT) delimitations. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering.








The resulting alignment shows the CDR3-IMGT of the germline V-REGION alleles of the IMGT reference directory sets. The CDR3-IMGT of the input rearranged sequence has to be identified in the translation of the JUNCTION (see above).
The correct amino acid numbering of the rearranged CDR3-IMGT is the one shown in the Results of IMGT/JunctionAnalysis or translation of the JUNCTION

7. V-REGION translation
.
The "Translation of the input sequence" shows the nucleotide sequence and deduced amino acid translation of the input sequence, aligned with the V-REGION of the closest germline V-GENE, and with the FR-IMGT and CDR-IMGT delimitations.
The 3' limit of the CDR3-IMGT of the input rearranged sequence is correctly identified if the conserved Phe/Trp-Gly-X-Gly motif of the J-REGION has been identified. If not, the 3' limit of the CDR3-IMGT needs to be checked
The correct amino acid numbering of the rearranged CDR3-IMGT is the one shown in the Results of IMGT/JunctionAnalysis or translation of the JUNCTION







8. V-REGION protein display
.
The "V-REGION protein display" shows the deduced amino acid translation of the input sequence, aligned with the V-REGION of the closest germline V-GENE, and with the FR-IMGT and CDR-IMGT delimitations.
On the third line of the alignment are shown in bold, the input sequence amino acids which different from the closest germline.







9. V-REGION mutation table
.

The "V-REGION mutation table" shows the mutations of the input sequence by comparison with the V-REGION of the closest germline V-GENE. Mutations are described according to the IMGT Scientific chart rules and according to the IMGT unique numbering for V-REGION. Mutations are shown for FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT and for the part of the CDR3-IMGT which can be compared with the V-REGION .

IMGT mutation and AA change description "g36>a" means that the nucleotide "g" at position 36 of the V-REGION of the closest germline V-GENE has been mutated to "a". If the mutation is nonsilent, the corresponding amino acid change is indicated. "t88>c, F30>L" means that the nucleotide "t" at position 88 of the V-REGION of the closest germline V-GENE has been mutated to "c" and that the amino acid "F" at position 30 has been changed to "L". For each amino acid change, the IMGT amino acid classes [8] that are conserved despite the amino acid change are indicated with "+" between parentheses in the following order: hydropathy, volume, chemical characteristics. For example, F30>L (+ - -) indicates that the two amino acids, F and L, belongs to the same hydropathy class but that the volume and the chemical characteristics classes are different. The AA changes are qualified as: Very similar: (+ + +) Similar: (+ + -) or (+ - +) Dissimilar: (+ - -) or (- + -) or (- - +) Very dissimilar: (- - -) As a consequence, two compared AA are qualified as: Identical Very similar Similar Dissimilar Very dissimilar







10. V-REGION mutation statistics
The "V-REGION mutation statistics" shows the number of mutations and amino acid changes, by comparison with the V-REGION of the closest germline V-GENE. Numbers of mutations and amino acid changes are shown for the whole V-REGION, the FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT and the part of the CDR3-IMGT which can be compared with the V-REGION.
Note that the number of mutations for the V-REGION and the CDR3-IMGT are calculated with the 3' end delimitation determined by IMGT/JunctionAnalysis. Numbers added between parentheses for the V-REGION and the CDR3-IMGT indicate the number of nucleotide differences without taking into account the shortening of the V-REGION. These numbers include nucleotide differences that result from the N-diversity.
Nucleotides : the number of silent and nonsilent mutations is evaluated, as well as each type of transition and transversion.
Amino acids : The number of identical AA and AA changes is evaluated as well as each type of AA changes.



11. V-REGION mutation hot spots
.
The motifs, the positions and the FR-IMGT or CDR-IMGT localisation of hot spots within the closest germline V-REGION are listed.



12. IMGT Collier de Perles for the input sequence V-DOMAIN
.

The IMGT Collier de Perles 2D graphical representation is automatically generated by the IMGT/Collier-de-Perles tool program (originally developed by Gérard Mennessier (LPM, Montpellier, France), Manuel Ruiz, Quentin Kaas and Fran�ois Ehrenmann (LIGM, Montpellier, France)),

The IMGT IMGT/Collier de Perles for V-DOMAINs are according to the IMGT unique numbering for V-DOMAIN [7].
IMGT amino acid classes (hydropathy, volume, chemical characteristics) are according to Pommié et al [8].

Note that: if the option "IMGT Collier de Perles (for a nb of sequences < 5)" has been selected in "Selection for results display" of the Search page, the Collier de Perles in PNG format is shown (except for TR aplha sequences). Because of several submitted sequences, some IMGT Collier de Perles may wrongly displayed.


IMGT Collier de Perles







13. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA.
.

The sequences of V-REGION and V-D-J or V-J -REGION are displayed with gaps according to the IMGT unique numbering, in nucleotide and in amino acid, in FASTA format. Amino acid sequences are also displayed on one line.








Note that the V-J- or V-D-J- REGION amino acid sequences are shown in red for unproductive sequences with an out-of-frame junction.

14. Annotations by IMGT/Automat
.
The annotation of the V-REGION, V-J-REGION and /or V-D-J-REGION of the input sequence is provided by IMGT/Automat [9].

The number of analysed sequences is indicated.


Result summary

The result summary is provided as a table with one row for each input sequence, including:
• The name of the sequence.
• The name of the closest V-GENE and allele. Note that a note may appear with the V-GENE and allele name: (1) indicates that the V score is very low (less than 200), and/or the V identity percentage is less than 85% and/or when the closest germline and the analysed sequence show different CDR1-IMGT and/or CDR2-IMGT amino acid lengths
  The alignment for this sequence has to be checked in A. Detailed view for detection of potential nucleotide insertions and/or deletions,.
• The functionality of the sequence. When found, the presence of stop codons is indicated.
• The V score
• The percentage of identity
• The name of the closest J-GENE and allele. Note that two notes may appear with the J-GENE and allele name:
  (a) indicates that other possibilities exist for the choice of the J-GENE and allele name.
  
• The D-GENE and allele name, the D reading frame , the CDR-IMGT lengths, the AA JUNCTION and the JUNCTION frame are provided according to the IMGT/JunctionAnalysis results.
  In the absence of results of IMGT/JunctionAnalysis, only the AA JUNCTION defined by IMGT/V-QUEST is displayed.


Results of IMGT/JunctionAnalysis

Links to the results of IMGT/JunctionAnalysis for the junctions are provided .

Alignment with the closest alleles

The names of the closest V-GENE alleles with which your sequences have been aligned are shown, with the number of sequences aligned to each allele indicated between parentheses.
The name of each allele is directly linked to its corresponding results.

Results for each V-GENE and allele

The results may include (if selected in the input page):
1. Alignment for V-GENE
2. V-REGION alignment
3. V-REGION translation
4. V-REGION protein display
5. V-REGION protein display with colored AA according to IMGT AA classes
6. V-REGION protein display (mutations displayed)
7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT
8. Results of IMGT/JunctionAnalysis

Example : the sequence of AF184762 accession number.




1. Alignments for the V-GENE

   
   This alignment shows your sequences which express the same V aligned with the closest V-REGION allele from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.

   • Hot spot positions are underlined in the V-REGION or the closest allele.
   • The score is indicated for each user sequences.
   • The name of the closest J-GENE allele, if found, is indicated at the end of th alignment

   

2. V-REGION alignment.
   
   The sequences are shown with the IMGT unique numbering and with the IMGT framework region ( FR-IMGT) and complementarity determining region ( CDR-IMGT) delimitations. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering.

   
   

   • Hot spot positions are underlined in the V-REGION or the closest allele.
   • The score is indicated for each user sequences.
   • The name of the closest J-GENE allele, if found, is indicated at the end of th alignment





The resulting alignment shows the CDR3-IMGT of the germline V-REGION alleles of the IMGT reference directory sets.

3. V-REGION Translation
.
The "V-REGION Translation " shows the nucleotide sequence and deduced amino acid translation of the closest V-REGION aligned with the user sequences, and with the FR-IMGT and CDR-IMGT delimitations.

• Hot spot positions are underlined in the V-REGION or the closest allele.
• The score is indicated for each user sequences.
• The name of the closest J-GENE allele, if found, is indicated at the end of th alignment






4. V-REGION protein display
   
   The "V-REGION protein display" shows the V-REGION protein display of user sequences aligned with the closest V-REGION allele.

   
   

   
   
   
5. V-REGION protein display with colored AA according to the AA IMGT Classes.
   
   The "V-REGION protein display" shows the V-REGION protein display of user sequences aligned with the closest V-REGION allele with colored AA according to the AA IMGT Classes.

   
   

   
   
   
6. V-REGION protein display (mutations displayed)
   
   The "V-REGION protein display" shows the V-REGION protein display of user sequences aligned with the closest V-REGION allele with only the mutations displayed.

   
   

   
   
   
7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT
   The "V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT" shows a table, for each FR-IMGT and CDR-IMGT, indicating for each amino acid position the most frequently occurring AA.
   
   
   
8. Results of IMGT/JunctionAnalysis
   The "Results of IMGT/JunctionAnalysis" shows the results of IMGT/JunctionAnalysis of JUNCTION user sequences per chain type, including Analysis of the JUNCTIONs and Translation of the JUNCTIONs
   
   
   

• A human IG Sequence set to test IMGT/V-QUEST for insertions or deletions is available here
• Insertions or deletions near the 5' end of the V-REGION may not be detected.

1. Results provided in case of insertions
   • in "Detailed view"
     • The detected nucleotide insertions in the submitted sequence by comparison to the IMGT unique numbering are displayed as capital letters in the FASTA sequence (at the top of results).
     • The insertions are described in the Result summary table with:
       - their localization in V-REGION
       - the display of inserted nucleotides
       - the indication if the insertions cause a frameshift
       - the V-REGION codon number (according to the IMGT numbering) from which begin the insertions
       - the nucleotide position in user submitted sequence from which begin the insertions
       
     • Then IMGT/V-QUEST provides the results of the analysis after removal of the insertions (functionality evaluation, gene and allele identification, ...).
     • In "identity" cell are shown between brackets the percentage of identity and ratio considering each insertion or deletion as one mutational event.
       If (an) insertion(s) is (are) detected, the percentage of identity is calculated after removal of the insertions. Each insertion is then counted as one mutational event whatever its length. The resulting percentage of identity and ratio are shown between brackets.
     

   • in "Synthesis view"
     • IMGT/V-QUEST provides the results of the analysis after removal of the insertions
     • A note indicates the sequences for which insertions have been detected. It is strongly recommended to check the description of the insertions in "Detailed view".
     
2. Results provided in case of deletions
   • in "Detailed view"

     • The deletions are described in the Result summary table with:
       - their localization in V-REGION
       - the number tof deleted nucleotides - the indication if the deletions cause a frameshift
       - the V-REGION codon number (according to the IMGT numbering) from which begin the deletions
       - the nucleotide position in user submitted sequence from which begin the deletions
       
     • Then IMGT/V-QUEST provides the results of the analysis after filling the deletion(s) gap(s) to restore the IMGT numbering (functionality evaluation, gene and allele idntification, ...)
     • In "identity" cell are shown between brackets the percentage of identity and ratio considering each insertion or deletion as one mutational event.
       If (a) deletion(s) is (are) detected, the percentage of identity is calculated after after filling the deletion(s) gap(s). Each deltion is then counted as one mutational event whatever its length. The resulting percentage of identity and ratio are shown between brackets.
     

   • in "Synthesis view"
     • IMGT/V-QUEST provides the results of the analysis after filling the deletion(s) gap(s) to restore the IMGT numbering
     • A note indicates the sequences for which deletions have been detected. It is strongly recommended to check the description of the deletions in "Detailed view".
     

1. The Summary sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality: provides the functionality. A message «(see comment)» may be added. It indicates that a comment related to the functionality has been added in the column «Functionality comment»
   • V-GENE and allele: provides the closest V-GENE and allele name(s). A message «(see comment)» may be added. It indicates that a comment related to potential insertions and/or deletions has been added in the column «V-REGION potential ins/del».
   • V-REGION score
   • V-REGION identity %
   • V-REGION identity nt
   • V-REGION identity % (with ins/del events): this field is shown if the option «Search for insertions and deletions» is selected. It indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides
   • V-REGION identity nt (with ins/del events): this field is shown if the option «Search for insertions and deletions» is selected. It indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides
   • J-GENE and allele: provides the closest J-GENE and allele name(s). A message «(see comment)» may be added. It indicates that a comment related to other possibilities for the J identification has been added in the column «J-GENE and allele comment».
   • J-REGION score
   • J-REGION identity %
   • J-REGION identity nt
   • D-GENE and allele: provides the closest D-GENE and allele name(s) identified by IMGT/JunctionAnalysis
   • D-REGION reading frame
   • CDR1-IMGT length
   • CDR2-IMGT length
   • CDR3-IMGT length
   • CDR-IMGT lengths
   • FR-IMGT lengths
   • AA JUNCTION (with restored frameshift for out-of-frame junctions, indicated with # in the sequence)
   • JUNCTION frame
   • Orientation: a sign + indicates «sense» orientation for the cDNA. A sign « indicates «antisens orientation» and therefore, that the sequence was complementary reversed for the IMGT/V-QUEST analysis.
   • Functionality comment: explains why a sequence has been identified as «unproductive»
   • V-REGION potential ins/del: this field is filled if the option «Search for insertions and deletions» is not selected and if insertions or deletions may be suspected.
   • J-GENE and allele comment: this field is filled if other possibilities exist for the choice of the J-GENE and allele
   • V-REGION insertions: this field is shown if the option «Search for insertions and deletions» is selected. It indicates the localization of the insertion(s)
   • V-REGION deletions: this field is shown if the option «Search for insertions and deletions » is selected. It indicates the localization of the deletion(s)
   • Sequence: the user sequence
     Note that : if the option "Search for insertions and deletions" is selected and if insertions have been detected, they appear in capital letters in the user sequence. The results provided in the other sheets of the Excel file correspond to the IMGT/V-QUEST analysis after removal of the insertions.
2. The IMGT-gapped-nt-sequences sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • J-GENE and allele
   • D-GENE and allele
   • Then nt-sequences of:
     • V-D-J-REGION : gapped according to the IMGT numbering, if described
     • V-J-REGION : gapped according to the IMGT numbering, if described
     • V-REGION : gapped according to the IMGT numbering
     • FR1-IMGT: gapped according to the IMGT numbering
     • CDR1-IMGT: gapped according to the IMGT numbering
     • FR2-IMGT: gapped according to the IMGT numbering
     • CDR2-IMGT: gapped according to the IMGT numbering
     • FR3-IMGT: gapped according to the IMGT numbering
     • CDR3-IMGT
     • JUNCTION
     • J-REGION
     • FR4-IMGT
3. The nt-sequences sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • J-GENE and allele
   • D-GENE and allele
   • Then nt-sequences of all constitutive labels of the V-J or V-D-J-REGION
     • V-D-J-REGION: if described
     • V-J-REGION if described
     • V-REGION
     • FR1-IMGT
     • CDR1-IMGT
     • FR2-IMGT
     • CDR2-IMGT
     • FR3-IMGT
     • CDR3-IMGT
     • JUNCTION
     • labels of the JUNCTION (see 6, Junction sheet section, 'nt sequence of') and N-AND-D-REGION
     • D-J-REGION
     • J-REGION
     • FR4-IMGT
     • Start and end positions of all constitutive labels of the V-J or V-D-J-REGION
4. The IMGT-gapped-AA-sequences sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • J-GENE and allele
   • D-GENE and allele
   • Then AA-sequences of:
     • V-D-J-REGION : gapped according to the IMGT numbering, if described
     • V-J-REGION : gapped according to the IMGT numbering, if described
     • V-REGION : gapped according to the IMGT numbering
     • FR1-IMGT: gapped according to the IMGT numbering
     • CDR1-IMGT: gapped according to the IMGT numbering
     • FR2-IMGT: gapped according to the IMGT numbering
     • CDR2-IMGT: gapped according to the IMGT numbering
     • FR3-IMGT: gapped according to the IMGT numbering
     • CDR3-IMGT
     • JUNCTION
     • J-REGION
     • FR4-IMGT
5. The AA-sequences sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • J-GENE and allele
   • D-GENE and allele
   • Then, AA-sequences of:
     • V-D-J-REGION: if described
     • V-J-REGION if described
     • V-REGION
     • FR1-IMGT
     • CDR1-IMGT
     • FR2-IMGT
     • CDR2-IMGT
     • FR3-IMGT
     • CDR3-IMGT
     • JUNCTION
     • J-REGION
     • FR4-IMGT
6. The Junction sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • J-GENE and allele
   • D-GENE and allele
   • JUNCTION frame
   • Then nt-sequences of labels of the JUNCTION:
     • JUNCTION
     • JUNCTION with restored frameshift, for out-of-frame junctions
     • 3'V-REGION
     • P3'V: palindromic (P) nucleotides added downstream (in 3') of the V-REGION
     • N-REGION
     • N1-REGION
     • P5'D: palindromic (P) nucleotides added upstream (in 5') of the D-REGION
     • D-REGION
     • P3'D: palindromic (P) nucleotides added downstream (in 3') of the D-REGION
     • N2-REGION
     • P5'J: palindromic (P) nucleotides added upstream (in 5') of the J-REGION
     • 5'J-REGION
   • Number of nucleotides (nt-nb):
     • Sequence number
     • JUNCTION nt nb
     • 3'V-REGION nt nb
     • P3'V nt nb: number of palindromic (P) nucleotides added downstream (in 3') of the V-REGION
     • N-REGION nt nb
     • N1-REGION nt nb
     • P5'D nt nb: number of palindromic (P) nucleotides added upstream (in 5') of the D-REGION
     • D-REGION nt nb
     • P3'D nt nb: number of palindromic (P) nucleotides added downstream (in 3') of the D-REGION
     • N2-REGION nt nb
     • P5'J nt nb: number of palindromic (P) nucleotides added downstream (in 5') of the J-REGION
     • 5'J-REGION nt nb
   • The number of trimmed nt (trimmed-nt nb):
     • 3'V-REGION trimmed-nt nb: number of V nucleotides trimmed off the 3' end of the germline V-REGION
     • D-REGION 5' trimmed-nt nb: number of D nucleotides trimmed off the 5' end of the germline D-REGION
     • D-REGION 3' trimmed-nt nb: number of D nucleotides trimmed off the 3' end of the germline D-REGION
     • 5'J-REGION trimmed-nt nb: number of J nucleotides trimmed off the 5' end of germline J-REGION
   • The number of mutations (mut-nt nb):
     • 3'V-REGION mut-nt nb: number of mutations detected in the 3'V-REGION
     • D-REGION mut-nt nb: number of mutations detected in the D-REGION
     • 5'J-REGION mut-nt nb: number of mutations detected in the J-REGION
   • D-REGION reading frame
   • Ngc: gc ratio in nt-sequences encoding N-REGION(s) (N-REGION or N1-REGION+N2-REGION, etc.)
   • Molecular mass
   • pI
   • The parameters used by IMGT/JunctionAnalysis:
     • 3'V-REGION accepted-mut nb: number of accepted mutation in the 3'V-REGION, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
     • D-REGION accepted-mut nb: number of accepted mutations in the D-REGION, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
     • 5'J-REGION accepted mut-nb: number of accepted mutation in the 5'J-REGION, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
     • Nb of accepted D-GENE in the JUNCTION for IGH, TRB and TRD loci, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
7. The V-REGION-mutation-table sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • Then, list of mutations (nt mutation, AA change, AA class identity (+) or change (-), for example t88>c, F30>L(+--)) for:
     • V-REGION
     • FR1-IMGT
     • CDR1-IMGT
     • FR2-IMGT
     • CDR2-IMGT
     • FR3-IMGT
     • CDR3-IMGT
8. The V-REGION-nt-mutation-statistics sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • Then, for V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT, CDR3-IMGT:
     • Nb of positions including IMGT gaps
     • Nb of nucleotides
     • Nb of identical nucleotides
     • Total nb of mutations
     • Nb of silent mutations
     • Nb of nonsilent mutations
     • The number of transitions
       • a>g
       • g>a
       • c>t
       • t>c
     • The number of transversions
       • a>c
       • c>a
       • a>t
       • t>a
       • g>c
       • c>g
       • g>t
       • t>g
9. The V-REGION-AA-mutation-statistics sheet includes:
   • Sequence number
   • Sequence ID
   • Functionality
   • V-GENE and allele
   • Then, for V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT, CDR3-IMGT:
     • Nb of positions including IMGT gaps (AA)
     • Nb of AA
     • Nb of identical AA
     • Total nb of AA changes
     • Nb of AA changes according to AAclassChangeType
       • +++
       • ++-
       • +-+
       • +--
       • -+-
       • --+
       • ---
     • Nb of AA class changes according to AAclassSimilarityDegree
       • Nb of Very similar
       • Nb of Similar
       • Nb of Dissimilar
       • Nb of Very dissimilar
10. The V-REGION-mutation-hot-spots sheet includes:
    • Sequence number
    • Sequence Id
    • Functionality
    • V-GENE and allele
    • Then, Hot spots motifs detected in the closest germline V-REGION with positions and CDR-IMGT and FR-IMGT localization
      • (a/t)a
      • t(a/t)
      • (a/g)g(c/t)(a/t)
      • (a/t)(a/g)c(c/t)
11. The Parameters sheet includes the date of the analysis, and the general and advanced parameters used by IMGT/V-QUEST:
    • Date of the analysis
    • IMGT/V-QUEST version
    • Species selected for the IMGT reference directory
    • Then, selected Advanced parameters:
      • IMGT reference directory set
      • With allele *01 only : indicated only if that option was selected
      • Search for insertions and deletions: yes or no
      • Nb of nucleotides to add (or exclude) in 3' of the V-REGION for the evaluation of the alignment score: indicated only if that option was selected
      • Nb of nucleotides to exclude in 5' of the V-REGION for the evaluation of the nb of mutations: indicated only if that option was selected.

• 11th of May 2006 (Version 2.0.0)
  IMGT/V-QUEST has been upgraded for multiple sequences and with new functionalities:
  1. IMGT/V-QUEST is able to analyse sereral nucleotide sequences in a single run.
     
     Note that:
     • The sequences must be in FASTA format as shown in the "IMGT/V-QUEST selection and input" section.
     • More than 10 sequences submitted in a single run will cause potential slow answer.
     • The number of submitted sequences in a single run has been limited to 50.

  2. New functionalities:
     • IMGT/V-QUEST is able to analyse inverse complementary sequences.

     • Nucleotide letters are always in lower cases, amino acids letters are always in upper cases.

     • The user may set the number of accepted D-GENE(s) in IGH, TRB and TRD JUNCTIONs for IMGT/JuntionAnalysis.

     • The user may visualize all eligible D-GENE(s) in IGH, TRB and TRD JUNCTIONs found by IMGT/JuntionAnalysis).

     • The IMGT Colliers de Perles include the representation of the CDR3-IMGT loop and are available:

       - in PNG (Portable Network Graphics) format
       - in interactive SGV (Scalable Vector Graphics) format (IMGT Collier de Perles on one layer and on two layers).

       SGV files require an SVG viewer (Firefox 1.5 or Internet explorer with Adobe SVG browser).

     • IMGT/V-QUEST performs additional analysis for the V-REGION as shown in IMGT/V-QUEST output:
       • V-REGION mutation table,
       • V-REGION mutation statistics,
       • V-REGION mutation hot spots.

     • IMGT/V-QUEST provides the automatic annotations of your input sequence(s) using IMGT/Automat [3]

     • The 3' end of the V-REGION is defined by IMGT/JunctionAnalysis. If not, it is set downstream of the last 2 nucleotides in 3' that are identical to the closest germline V-REGION.

     • IMGT/V-QUEST performs the numbering of the CDR3-IMGT according to the IMGT unique numbering.

     • The user may select the types of results he wants to display.

     • The user may select the number of nucleotides per line in the alignments (60, 90, 120, 150 or 10,000).

     • The user may set a number of nucleotides to exclude in 5' of the V-REGION, for instance when the primer used for the PCR amplification is located at the beginning of the FR1-IMGT. The excluded nucleotides will not be taken into account in V-REGION mutation table and in V-REGION mutation statistics

• 15th of November 2006 (Version 2.1.0)
  IMGT/V-QUEST has been upgraded to provide a Synthesis view of results. The Synthesis view provides alignements of user sequences which express the same V allele, including
  1. Alignment for V-GENE
  2. V-REGION alignment
  3. V-REGION translation
  4. V-REGION protein Display
  5. V-REGION protein Display with colored AA according to IMGT AA classes
  6. V-REGION protein Display (mutations displayed)
  7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT
  8. Results of IMGT/JunctionAnalysis
• 10th of April 2007 (Version 2.2.0)

• The gene and allele functionality is only shown for pseudogene (P) and "ORF" (ORF) between parentheses.
• In 4. Results of IMGT/JunctionAnalysis, JUNCTION amino acids are colored according to the IMGT amino acid classes for chemical characteristics [8].
• In 4 .Results of IMGT/JunctionAnalysis, in case of frameshifts, they are indicated by a #.
• Update of the human IMGT reference directory set: addition of in-frame pseudogenes (with at most one stop codon)
  IGHV: IGHV1-68*01, IGHV3-22*01, IGHV3-22*02, IGHV3-25*03, IGHV3-52*01, IGHV3-52*02, IGHV3-52*03, IGHV3-71*01, IGHV5-78*01
  IGKV: IGKV2-4*01, IGKV2-18*01, IGKV2D-18*01, IGKV7-3*01
  IGLV: IGLV3-13*01
• 6th of July 2007 (Version 2.3.0)
  • A summary of the IMGT/V-QUEST results are provided in both Detailed view and Synthesis view.
  • The "Advanced parameters" section has been added at the bottom of the IMGT/V-QUEST query page. It allows:
    • to select the IMGT/V-QUEST reference directory set.
    • to define if the user sequences will be compared with all alleles or with only the allele *01 of the genes of the IMGT/V-QUEST reference directory set.
    • to set the number of D-GENEs to be allowed in the IGH, TRB and TRD JUNCTIONs for IMGT/JunctionAnalysis.
    • to set the number of accepted mutations in 3'V-REGION, D-REGION and 5'J-REGION for IMGT/JunctionAnalysis.
    • to set the number of nucleotides to exclude in 5' of the V-REGION for V-REGION mutation table and V-REGION mutation statistics (for Detailed view results number 8 and 9).
    • to set the number of nucleotides to add or to exclude in 3' of the V-REGION for the evaluation of the alignment score (for Detailed view result 1).
  • in-frame pseudogenes and orphons have been included in the IMGT/V-QUEST reference directory sets.
• 20th of July 2007 (Version 2.4.0)
  • Addition of 17 Mus musculus IGHV genes:
    IGHV1-70*01, IGHV1-71*01, IGHV1-72*01, IGHV8-13*01, IGHV1-74*01, IGHV8-14*01, IGHV1-75*01, IGHV1-76*01, IGHV1-77*01, IGHV1-78*01, IGHV1-79*01, IGHV1-80*01, IGHV1-81*01, IGHV1-82*01, IGHV1-83*01, IGHV1-84*01, IGHV1-85*01
  • Addition of a new species: rat (Rattus norvegicus)
    • 83 IGHV (test for IGHV2 and IGHV5 subgroups)
    • 19 IGHD
    • 4 IGHJ
• 25th of July 2007 (Version 2.4.1)
  • Addition of 10 Mus musculus IGHV genes:
    IGHV1-19-1*01, IGHV1-17-1*01, IGHV1-21-1*01, IGHV1-62-1*01, IGHV1-62-2*01,IGHV1-62-3*01, IGHV2-6*03, IGHV2-6-8*01, IGHV5-9-1*02, IGHV14-4*01

• 14th of September 2007 (Version 2.4.2)
  • Input sequence treatment: 5' and 3' terminal "n" nucleotides are automatically removed until the first 5' and 3' non "n" nucleotide, respectively

  • Addition of Homo sapiens IGHV1-69*12, IGHV1-69*13, TRAJ13*02, TRGJ1*02, TRBV23/OR9-2*02 alleles
  • Addition of Mus musculusIGKV17/OR19-2*01, IGKV17/OR16-3*01 and IGKV17/OR19-2*01 genes, and TRAJ21*02 allele
  • The allele Mus musculus IGHV1-11*02 has been assigned to IGHV1-84*02.
  • The allele Mus musculus IGHV3S4*01 has been assigned to IGHV3-3*03.

• 8th of November 2007 (Version 2.4.3)
  • In the Result sumary table, a note (a) appears with the functionality when the V identity percentage is less than 85% and/or when the closest germline and the analysed sequence show different CDR1-IMGT and/or CDR2-IMGT amino acid lengths in order to point out potential nucleotide insertion(s) and/or deletion(s).
• 6th of December 2007 (Version 2.4.4)
  • Update of Rattus norvegicus IGHV reference directory : subgroups IGHV1, IGHV2, IGHV3, IGHV4, IGHV5, IGHV6, IGHV7, IGHV8, IGHV9, IGHV10, IGHV11, IGHV12, IGHV13 and IGHV14 included
  • Update of the Mus musculus IGHV reference directory.

• 12th of December 2007 (Version 2.4.5)
  • Correction of a small bug in the detection of the closest Mus musculus genes and alleles.
  • Update of the Mus musculus IGHV reference directory.
• 29th of January 2008 (Version 2.5.0)
  • Addition of an option in Advanced parameters: "Search for insertions and deletions"
  • Update of Rattus norvegicus IGHV reference directory
  • Update of Mus musculus IGHV reference directory
• 8th of February 2008 (Version 2.5.1)
  • Addition of Homo sapiens IGHV3-49*04, IGHV3-49*05 and IGHV4-39*07 alleles
• 19th of February 2008 (Version 3.0.0)
  • From this release, gaps in CDR1-IMGT and CDR2-IMGT are placed at the top of the loops
• 18th of March 2008 (Version 3.1.0)
  • Addition of an option in Selection for results display, Detailed view: "V-REGION protein display"
• 4th of July 2008 (Version 3.1.1)
  • Addition of 7 Rattus norvegicus IGLV and 3 Rattus norvegicus IGLJ genes and alleles
  • Improvement of Detailed view "10. V-REGION mutation statistics"
  • Translation of the JUNCTION" when the option "Export in text" has been selected, has been slightly modified in order to be closer to the HTML format. In addition, Molecular mass and Pi of out-of-frame junctions are indicated as NR (not relevant).
  • Correction of a small bug in the V numbering of partial sequences
• 18th of July 2008 (Version 3.1.2)
  • Addition of 4 new Homo sapiens IGKV genes and alleles: IGKV1-16*02, IGKV1D-17*02, IGKV2-30*02 and IGKV3-7*04
  • Correction of a bug in Detailed view "10. V-REGION mutation statistics" for the evaluation of amino acid number per IMGT label in case of amino acid changes at the end the 3'V-REGION
• 23th of October 2008 (Version 3.1.3)
  • Addition of a new Rattus norvegicus IGHD gene and allele: IGHD3-4*01
  • The pseudogene Homo sapiens IGHV3-g*01 gene has been removed from the IMGT reference directory : it corresponds to the Homo sapiens mapped pseudogene IGHV3-71*01
• 19th of November 2008 (Version 3.1.4)
  • Addition of Mus musculus TRAJ26*01 allele
• 4th of December 2008 (Version 3.1.5)
  • Addition of a new Rattus norvegicus IGLJ gene and allele: IGLJ4*01
• 4th of February 2009 (Version 3.1.6)
  • Addition of Rattus norvegicus IGHV2S58*01 and IGHV5S2*01
• 27th of April 2009 (Version 3.2.0)
  • Addition of "Export in Excel file" output : the "Detailed view" results are recorded in 11 sheets.
  • Query Page : the option "2. Alignment for D-GENE" of "A. Detailed view" is no more selected by default.
  • A. Detailed view results:
    • In "Result summary", D-GENE(s) and allele(s) are shown only if identified by IMGT/JunctionAnalysis"
    • In "4. Results of IMGT/JunctionAnalysis"
      • In case of unmutated IGK or IGL V-GENE (no mutations in FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT and FR3-IMGT), the number of allowed mutations in 3'V-REGION and 5'J-REGION has been set to 2.
      • The number of accepted D-GENE in the junction is indicated
    • In "10. V-REGION mutation statistics": update of the presentation of the amino acid table
    • In "11. V-REGION mutation hot spots": the tables are displayed as follow: (a/t)a, t(a/t), (a/g)g(c/t)(a/t), (a/t)(a/g)c(c/t)
    • In "13. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA": the V-J- or V-D-J- REGION amino acid sequences are shown in red for unproductive sequences with an out-of-frame junction.
  • "Export in text" output : elimination of HTML tags (except for option "5. V-REGION protein display with colored AA according to the AA IMGT Classes" of Synthesis View).
  • "B. Synthesis view results": in "7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT", a message is added when, at a given position, 100% of the analyzed sequences have the same AA change.
  • Update of IMGT gap positions in Homo sapiens IGHV3-72*02.

• 30th of April 2009 (Version 3.2.1)
  • A. Detailed view results, "10. V-REGION mutation statistics": update of the presentation of the amino acid table

• 5th of May 2009 (Version 3.2.2)
  • Update of numbering for user sequences close to a reference sequence partial in 5'.

• 15th of May 2009 (Version 3.2.3)
  • Correction of a bug in the "V-REGION-nt-mutation-statistics" sheet of the Excel output.

• 15th of June 2009 (Version 3.2.4)
  • Update of the IMGT/V-QUEST query pages.
  • "Results in text" output :elimination of HTML header and footer.
  • "Results in text" for B. Synthesis view output: due to text format, hot spot positions are not more underlined in "1. Alignment for V-GENE", "2. V-REGION alignment according to the IMGT unique numbering", "3. V-REGION translation". The option "5. V-REGION protein display with colored AA according to the AA IMGT Classes" is not more available.
  • A. Detailed view, option "14. Annotation by IMGT/Automat": addition of the label D-J-REGION.
  • "Results in Excel", "nt-sequences" sheet: addition of the label D-J-REGION.
  • update of Mus musculus IGHV2-6-3*01 reference sequence.

• 27th of July 2009 (Version 3.2.5)
  • Improvement of the description of the JUNCTION for human, mouse and rat sequences with no W/FGXG conserved motif in the closest J gene.
  • Improvement of the detection of P nucleotides in the JUNCTION (IMGT/JunctionAnalysis).
  • In results of "A. Detailed view", option "12. IMGT Collier de Perles": Addition of CDR_length and FR_length.
  • In results of "A. Detailed view", option "14. Annotation by IMGT/Automat": the qualifiers CDR_length et FR_length are associated to the V-D-J-REGION or V-J-REGION (or, if not possible, to the V-REGION).
  • In results of "A. Detailed view", option "14. Annotation by IMGT/Automat": addition of the label N-AND-D-REGION.
  • In "Results in Excel", "nt-sequences" sheet: addition of the label N-AND-D-REGION.

• 28th of July 2009 (Version 3.2.6)
  • In results of "A. Detailed view": Addition of the date of the analysis at the end of the page.
  • In results of "B. Synthesis view": Addition of the date of the analysis at the end of the page.
  • In "Results in Excel", "Parameters" sheet: Addition of the date of the analysis .
  • In "Results in Excel", "IMGT-gapped-AA-sequences" sheet: update of the amino acid translation for sequences partial in 5'.

• 29th of July 2009 (Version 3.2.7)
  • Correction of a bug for the determination of the JUNCTION.

• 1st of September 2009 (Version 3.2.8)
  • In "Result summary" of "A. Detailed view" and in "Summary table" of "B. Synthesis view": addition of a note to the closest J-GENE and allele name when the JUNCTION has not been identified. It indicates that the results for J-GENE may not be reliable.
  • Improvement of the control of the validity of the J-GENE and allele identification.

• 5th of October 2009 (Version 3.2.9)
  • In "Result summary" of "A. Detailed view" and in "Summary table" of "B. Synthesis view": evaluation of identity percentage when insertion(s) and/or deletion(s) have been detected (option "Search for insertions and deletions" of Advanced parameters). Between brackets are shown the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides.
  • In "Results in Excel", in all sheets except "Parameters": addition of a column with the number of the analysed sequence.
  • In "Results in Excel", "Summary" sheet: when the option "Search for insertions and deletions" of Advanced parameters is selected, addition of 2 columns "V-REGION identity % (with ins/del events)" and "V-REGION identity nt (with ins/del events)" that indicate the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides.
  • Update of the evaluation of the number of amino acid changes at the end of the IMGT-CDR3.

• 27th of October 2009 (Version 3.2.10)
  • Data upgrade : Update of the rat IMGT reference directory set: Addition of 162 IGKV and 7 IGKJ genes and alleles.

• 18th of December 2009 (Version 3.2.11)
  • Data upgrade :
    - Update of the IMGT/V-QUEST reference sequences for : Homo sapiens IGHV1-45*02, Homo sapiens IGHV3-25*02, Homo sapiens IGHV3-48*03, Homo sapiens IGHV3-73*01.
    - Update of the IMGT/JunctionAnalysis: addition of Mus musculus TRAV7-1*01 and Mus musculus TRAV15D-2/DV6D-2*01.
  • Programme upgrade :
    - Update of IMGT/JunctionAnalysis to deal with TRAV/TRDJ and TRDV/TRAJ rearranged sequences
    - Update the annotations by IMGT/Automat.

• 22th of February 2010 (Version 3.2.12)
  • Data upgrade :
    - Addition of a new species: rabbit (Oryctolagus cuniculus):
    • 48 IGHV genes and alleles (40 F and 8 in-frame P)
    • 11 IGHD genes and alleles (10 F and 1 ORF)
    • 6 IGHJ genes and 11 alleles (F)
    • 66 IGKV genes and 68 alleles (66 F, 1 ORF, and 1 in-frame P)
    • 8 IGKJ genes and 19 alleles (8 F and 11 ORF)
    - Update of the human IGKV IMGT/V-QUEST reference sequences: addition of the orphon Homo sapiens IGKV1/ORY-1*01.
    - Update of the mouse IGKV IMGT/V-QUEST reference sequences: addition of Mus musculus IGKV10-94*07 and Mus musculus IGKV10-94*08.
    - Update of the trout IGHV IMGT/V-QUEST reference sequences: addition of Oncorhynchus mykiss IGHV5S10*01, Oncorhynchus mykiss IGHV2S2*02 and Oncorhynchus mykiss IGHV8S7*02.
    - Addition of the trout IGHD IMGT/V-QUEST reference sequences : 9 IGHD genes and alleles (F).
    - Addition of the trout IGHJ IMGT/V-QUEST reference sequences : 7 IGHJ genes and alleles (F).
    - Addition of the trout TRBV IMGT/V-QUEST reference sequences : 45 TRBV genes and alleles (39 F, 1 ORF and 5 in-frame P).
    - Addition of the trout TRBD IMGT/V-QUEST reference sequences : 1 TRBD gene and allele (F).
    - Addition of the trout TRBJ IMGT/V-QUEST reference sequences : 10 TRBJ genes and alleles (F).
    
  • Programme upgrade :
    - In results of "A. Detailed view", option 12. IMGT Collier de Perles: update of the display "IMGT Collier de Perles (for a nb of sequences < 5)".
    

• 26th of February 2010 (Version 3.2.13)
  • Data upgrade :
    - Update of the IMGT/V-QUEST reference sequences for : Oryctolagus cuniculus IGHV1S35*01, Oryctolagus cuniculus IGHV1S43*01, Oryctolagus cuniculus IGHV1S44*01, Oryctolagus cuniculus IGHV1S45*01, Oryctolagus cuniculus IGHV1S46*01.
    

• 3rd of March 2010 (Version 3.2.14)
  • Programme upgrade :
    - Improvement of the Excel file implementation.

References:

[1]	Giudicelli, V. et al. Nucl. Acids Res. 32, W435-440 (2004) PMID: 15215425 LIGM:287
[2]	Belessi C.J. et al. Eur J Immunol. 36, 1963-74 (2006).
[3]	Giudicelli, V. et al. Stud. Health Technol. Inform. 116, 3-8 (2005) LIGM: 298
[4]	Yousfi Monod, M. et al. Bioinformatics , 20, i379-i385 (2004) PMID: 15262823 LIGM:289
[5]	Lefranc, M.-P. Methods Mol. Biol. 248, 27-49 (2004) PMID: 14970490 LIGM:277
[6]	Lefranc, M.-P. Current Protocols in Immunology pp. A1W.1-A.1W.15 (2006):311
[7]	Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003) PMID: 12477501 LIGM:268
[8]	Pommié, C. et al. J. Mol. Recognit., 17, 17-32 (2004) PMID:14872534 LIGM:284
[9]	Giudicelli, V et al. In: Proceedings of the European Conference on Computational Biology (ECCB 2003), INRIA (DISC/Spid), Paris, DKB-31, pp.103-104.
[10]	Brochet, X. et al. Nucl. Acids Res. 36, W503-508 (2008). PMID:18503082 LIGM:344

IMGT/V-QUEST Search page
IMGT/V-QUEST Documentation

Contact IMGT/V-QUEST, Montpellier, France : Véronique Giudicelli (Veronique.Giudicelli@igh.cnrs.fr) and Marie-Paule Lefranc (Marie-Paule.Lefranc@igh.cnrs.fr)

Created: 07/07/1997
Last updated: 03/03/2010
Authors: Céline Protat, Véronique Giudicelli and Marie-Paule Lefranc.
Marie-Paule.Lefranc@igh.cnrs.fr

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT, and cited as "IMGT, the international ImMunoGeneTics information system® http://www.imgt.org (Initiator and coordinator: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Research, 27, 209-212 (1999) Cover of NAR; Ruiz, M. et al., Nucleic Acids Research, 28, 219-221 (2000); Lefranc, M.-P., Nucleic Acids Research, 29, 207-209 (2001), Lefranc, M.-P., Nucleic Acids Res., 31, 307-310 (2003) Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004), Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text; Lefranc, M.-P. et al., Nucleic Acids Research 2009 37(Database issue): D1006-D1012; doi:10.1093/nar/gkn838 Full text.

For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

-> IMGT Repertoire (IG and TR)
-> IMGT Repertoire (MHC)
-> IMGT Repertoire (RPI)
-> IMGT Index
-> IMGT Scientific chart
-> IMGT Education
-> IMGT Home page

IMGT initiator and coordinator: Marie-Paule Lefranc (Marie-Paule.Lefranc@igh.cnrs.fr) Bioinformatics manager: Véronique Giudicelli (Veronique.Giudicelli@igh.cnrs.fr) Computer manager: Patrice Duroux (Patrice.Duroux@igh.cnrs.fr) Interface design: Chantal Ginestoux (Chantal.Ginestoux@igh.cnrs.fr)
Citing IMGT Warranty disclaimer and copyright notice Privacy policy and advertisement policy © Copyright 1995-2010 IMGT®, the international ImMunoGeneTics information system®